Insertion MI02001

Gene Information

Affected Gene(s)
CG31183          

PositionCG31183 - coding intron
PhaseCG31183-RA:1, CG31183-RB:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R15867982-89A63R:15867982

FlyBase AnnotationTransposon
FBti0131792Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 33160

Flanking Sequence

MI02001
(HR505016)
GATCAAATGCTATTGTTTAATTACAGCTCATTTAATTTCATTTATTGACA
ATTAACACCGTACACAATTACAATCGTTATGCATATTTTTCGCGGCAGTC
GCGGCGCAGCGATTCACAATTCTATGCTAATTGAATTTTAATGGAAAACC
AATGCGAACCGAAAAGAAGATGTGGCAATCGACTAGGGAATTCCCTCGGT
AACGTGACTAATCAAATGGCATTTTAATGATAATGCACTGATATAAAAAT
CTAGCTTTTGTTAAAATTAAAATGCTAATTTAATGGAAATGAAGCTGGGC
AAATAATTTCATAGATTTAAAACCGCTGCGGGTGTCAATACCAATAAATT
ATGGCGAATTGAATGGCTTTTTAAATAACACATAATGATAGCTTTGATGT
GCCCCGAATTTCAATTGGCATATAGAATAATATTTTAAAGATGCCGACAA
GAAAGTATACATTTTATTGATACATAATCTAACAATATAACTGAGTTCAA
GGACAGAGTAACGATACTTTCCTTTTGAAGTGCCCAAAAAAATATTCGAT
C


Search Again