Insertion MI03010

Gene Information

Affected Gene(s)
Mmp1          

PositionMmp1 - coding intronMmp1 - 3' downstream
PhaseMmp1-RC:1, Mmp1-RE:1, Mmp1-RH:1, Mmp1-RI:1, Mmp1-RJ:1, Mmp1-RK:1, Mmp1-RL:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
2R24674615+60D132R:24674615

FlyBase AnnotationTransposon
FBti0143234Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 35918

Flanking Sequence

MI03010
(JM113908)
GATCTGGGACCTCAGTTAGTGAGACCGACTGACCAGTAGTTTTGGTTGCT
GTTGTTGTCGTTGCGGCTGATAATTGCTAATATATTCTCTTGGCTACTAA
ACTGTAAGCAAGGTATTATATTATTTTTGTTTTTATATTCTTTTTTTTTC
TTTTAAGTATCTTTGTACATGGTATGCTAAATTGAGTTGGTTAGTTTAAT
AGAATCAAAAAACTAAAAGTACCAAAAGCGTTACCAAGGATGGGTTAGTT
AAGTTAATGGAAAGAACACATTGTTAGTTGAAGATGAAATTAGCAAAGTT
GGGTTAGTTACAAAGTTTAGTTAGATAATTAGTACAGCTAGTTTAGAAAA
GTAATTACAACATTGGTTTCATTAAAATTAAGCTTAGAGGCTTACTCTAT
AGAAAAGTACTTTCACCAAATAAAACTCAGCATGAAAGCACTGAAACAAA
ACTAAAATAAAACACCACAAAATCAAGACTAGGAGAAGGTAAAATTGTAC
AATATTTGTATAAGGCACACGCTATATATGTATATACATATATATATATA
TATATAGACTGGCAAAAGACATTTGACACACACAGTTTGGTAATTAGTTT
TTCAATAGGTATTATAAATGTATTTCTTCCATAGGCAACAAAGACAAACA
CATTCGACTTGAGTACTAGAATTTCACTACATAGACATTAACTTAATTAA
ACATACCATAAAGATAGGATTTATTAATATTATCATTTCATTACTTGTAA
CTGCTTCTCGCTAAGTAACAACTCATACAAGACTTCTTTCTATGAGATC


Search Again