Insertion MI03270

Gene Information

Affected Gene(s)
sas          

Positionsas - coding intron
Phasesas-RA:1, sas-RB:1, sas-RC:1, sas-RD:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R7164895+84C83R:7164895

FlyBase AnnotationTransposon
FBti0145209Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 36413

Flanking Sequence

MI03270-3'
(JM496755)
TAGACGGCATCTACGCGACGACGCTCGCATAGCTGGGGCATCTCATCCCG
ATC
MI03270-5'
(JM496756)
GATCAAGTGGAGTAGAATGTGCCTGGCCACTCTCTGCGGATTACTTCTGC
TTGGCATTCAAATTGAGCGTGCGGCGTCTGCGCCCGCAGGCGAAGACGCA
GCGGCCACAACGATGCCACCTTTGGATACCACAACAGATGCCCCAGACGC
CGTTGCAGCCACCACCACTCCAGCCACAACTGCCGCAGAACAAAGCAGCA
GCATCAGCAGCATAACCACCGAGGCGGCGGATGGTTCAACGACTTCCACG
ACGACAACAACTGAGGCGGCCAACAAATCCAATGCGACCGAAACTGGTGA
GTCCAAGCCGAAAGCCATGAAAATTATAGATA


Search Again