Insertion MI08152

Gene Information

Affected Gene(s)
lncRNA:CR32773     bi     

Positionbi - coding intronlncRNA:CR32773 - 5' UTR intron
Phasebi-RA:0, bi-RB:0, bi-RC:0, bi-RD:0, bi-RE:0, bi-RF:0, bi-RG:0

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
X4469429-4C4X:4469429

FlyBase AnnotationTransposon
FBti0153120Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 51220

Flanking Sequence

MI08152-3'
(KG699232)
TAATCAGCACACACACACACACCGTCCAGCGTTGATTGAGGAAATTGTCG
TTGTTGTTCATTCATATTGGTTTCCCTTGCCCCGCACCAATTTGGCTAAT
CAGTTGCAACGGAAATCCCCCCCCGAAAATCAAGACAAATTTAAAATCAA
ACAAACTGGAGAAAATGAATACGAGTCTTATAAGGTAGTAGGTCGACTGC
CCACAATTTCCGTGCTCCCACAGCGATC
MI08152-5'
(KG699233)
GATCAAACGCAATATGTGTTTTTAATTAACTTTTTAGAGGTCATAAAGGT
TTTCAGACGGCAAGGTGCGCTGCAATCACCCCGAAAATGGGACCAATAAA
AACCAATTTCAATTCCAATTCCAATTTCCCTGACGGTGTGTGTGCTTGTC
GCTTCTTGCGGCTAATCGAGAAATTAAGTGTAAAATTATGTTA


Search Again