Insertion MI10540

Gene Information

Affected Gene(s)
Eip63F-1          

PositionEip63F-1 - coding intron
PhaseEip63F-1-RA:1, Eip63F-1-RB:1, Eip63F-1-RC:1, Eip63F-1-RD:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3L3921259-63F73L:3921259

FlyBase AnnotationTransposon
FBti0161973Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 56215

Flanking Sequence

MI10540-3'
(KG779616)
TATTCTAAAAATCTGTGGACCAAAGTCCACTTCTACGAAGCGCATTGCAA
ACGTTGATAGGTCACTTAAATATATAGTATATTAAATATAGTATAGTATG
TACATATATTAGTATTCAAAGGTTTACAAAATGCTGGCTGTGTTGACCTG
TTTAGGGAACTTTTCAGCCTAAAAACTTTGATGGAAGCCATCATCAATGT
TTTCCCAAGCTGTTGTATCATGCGAATCGCCATAATTTTCTTGCCTTCCT
CCATTACCGCATTTAGGCGAGCAAGTTGCATAGTTGATTGCACGCAAAGT
TATGCGCGATTGGAGAAATTATAAGTTTTGGCTAAGCGGCTATATTTATG
GCCACCTTTCTGGCGGGCCAACTGCAAGTTTGATC
MI10540-5'
(KG779617)
GATCCATGGGTTAACCTCAATATGTTCCAGTGTCCCGACACCTGTCATTC
CCTCCATACCGCAATCGCTCAGAGCTGCAGACACTGTGCGCTGAAATATT
GGTGTCAATGTGTCAATATTTGAAGTATAAACACGTGTGCAATTACAAAC
TATACAAGTACGGCGGCTCAAGTGTGTGTATGTGTGTGTGGTCGTATTAA
CAAAAGCTACGGCAACGGAAGTGCTCTACAAGCGCCGGAAAGTGGGGGAA
AATGGAAAAGGGCGGCGTTAAGGGGGCGTGGTCTGGCAGAAAAGCGGCTT
GGCCCAAAGCAATTTACATGCAATTTTCGCATATCTTCTTTCCCTATTCC
AGATTTTTCCTTTTACATCGGAAGCCTGCCAGAAGCAAGCGGCTGCCCTT
AAAGGATAATATTACTTTTTGCCCTCCTTTCGTTTTCTACATTTCGTTAC
ACTTAGCAACAATAAATGGTTTCTTAACGAAAACTTGAAAATA


Search Again