Insertion MI14951

Gene Information

Affected Gene(s)
Ets96B          

PositionEts96B - coding intron
PhaseEts96B-RB:1, Ets96B-RC:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
3R24795149-96A223R:24795149

FlyBase AnnotationTransposon
FBti0166769Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 59580

Flanking Sequence

MI14951-3'
(KO455341)
TAGCTTGAACTGAGAACGCCACGAAACAACCTTTAAATTTTTAAAGTAAC
TGATTTTTTTCTTCAAGTGTAAACGGATGGATGGGTGAATGGGGTGACTG
GGTGGTGTAGCTAACACGAACCACTCAACGGCGGCCCCGTGATTGAGCTG
TTTGTTCGATGGGCGTCGGATTCAGCCCTCGACCACGCCCCCGTCCGCCC
ACCGCCACGCCCACCGGAGGCGAACTATGTAGCAGCCGCCCCTCGAAATT
GAATTGCACGCTTGTTCTGCCGCCAATTGGATTAGCGGTTAGTAACACCG
ACGATATTGTTATTGTAAATTATGCGCGCGATTTCTTGCATTTTATTTGA
AAAAATATTGGTAGCCACTAGAAGAAGATGGCAGCAAATGGAATTACCCA
GTGATAGGTATGCATATCGCGCACAATAATTTGAATAAATGATGAGCGTA
CGCAAAAGCTGACTTTAATCATTTTCCATTCATTTTTTTCAATTTTTAGG
GACTTACCTTCGTCGCTCTTTTTCAGAATGCCCGCGGGTGGCGATGATGG
AAATCTGCATGGAGCATAAATCAAAAATATATAAAATATATATATACAAA
TCTATTTTATATAGAAAGCGGATAATTCAAGGAGCAAGCGACTCCGTTGA
TTGACTTAAAGTTGACTTGTCTTGTCAGCGTGAAGCTCAATCTCAATCTT
CTTACCTGTAGCAGTACGGGTGCGGAT
MI14951-5'
(KO455342)
GATCTTGTTTAAACTATGATATAATGTATATTTCATAAAGAATCAGCTGA
AATCTA


Search Again