Insertion MI15559

Gene Information

Affected Gene(s)
PlexB          

PositionPlexB - coding intron
PhasePlexB-RA:1, PlexB-RB:1

Release 6 Annotation

Scaffold Coordinate Strand Site GBrowse Link
441542+Het4:41542

FlyBase AnnotationTransposon
FBti0168917Mi{MIC}

Stock Availability

Donor/Collection Stockcenter Designation Stock No.
GDPBloomington 61730

Flanking Sequence

MI15559-3'
(KO488255)
TAGAGGTTGCTCCAGGCTCTCTCGAATTTTTGTTCGAGAGCGAGAGAGCG
GAGAGCGCTACAACGAACAGCTCTTTTCTACGCATACAGTGATACCAGAC
ATCTGTGTGTGTGCACACGTGTGCTCATGCATTGTAAATTTGACAATATA
TGCCCTTCACCTTAGAAGTTCATAGACTTTAAATCTATATTATTTTTGAT
C
MI15559-5'
(KO488256)
GATCTACTCATGTCCGTCTGCCTGTCCTTAGCCCACGATTTTCTCGCCGT
GGCTCTA


Search Again